Primers for a Simple Identification of Genetically Modified Soya (GTS) in Food by PCR

Lain Mencia Martinez, Christian Lozanoski, Dietmar Scherr, Max-Beckmann-Schule, Oberstufengymnasium in Frankfurt am Main, Sophienstr. 70, D-60487 Frankfurt

Abstract

Three PCR primer pairs for the specific, sensitive and rapid detection of genetically modified Soya (Glycine max) are described here. Soya containing the EPSPS gene (5-enolpyruvyl-3-phosphoshikimate synthase, EC 2.5.1.19 ) of bacterial origin /1/, /2/ (Agrobacterium sp. strain designated CP4 ), generating a glyphosate tolerance of soya plants, can be detected by three pairs of primers resulting in a 388 bp (bp = base pair), or alternatively a 267 bp or a 227 bp amplicon.

Key words Genetically modified soya, PCR Primers

Introduction

The detection of genetically modified Soya in food will be of great interest for all who are involved in surveying soya containing products /3/, /4/.Primers are described here that work very well under the simple conditions of a school laboratory, using a very slow thermocycler (Pharmacia LKB Gene ATAG Controller). The extraction of the genomic DNA of the samples which is essential for a qualified detection was performed by standard procedures (Promega). The primers were developed for a nested PCR but which is not necessary (Fig. 2). The primers yielding a 227 bp amplicon could be useful when DNA in food is very degradated.
 
 

Materials and methods

To avoid contamination the extractions and PCR were performed in different parts of the laboratory. Extractions, as well as the tubes and instruments for mincing were handeled in containments of plastic.
Soya seed was soaked at 65 °C for 1 h before extraction.
As an example for food containing genetically modified soya (soya protein) we describe here experiments with Nestle Salvimulsin MCT "Sondennahrung". The suspension was directly extracted.
 
 

Extraction

200 mg of the minced soya seed sample or 300 µl of the suspension (Nestle Sondennahrung) was mixed with 500 µl of extraction buffer (10 mM Tris-HCl, 150 mM NaCl, 2mM EDTA, w = 1% SDS), 50 µl 5 M Guanidin- HCl solution (Serva), 20 µl of Proteinase K (Boehringer Mannheim) (20mg/ml). The tube was inverted and incubated for at least 1 h at 57 °C, followed by a centrifugation for 10 min at 10000 x g at room temperature. The solution was added to 1 ml of Wizard DNA purification resin (Promega, no. A 767C) and the Promega clean-up procedure was performed. The DNA was eluted with 80 °C heated TE buffer (Tris-HCl, pH 7.5, 1 mM EDTA)
 
 

Preparation of standards

DNA extracts of genetically modified seed was diluted 1 : 10, 1 : 100, 1 : 1000, 1 : 3000 and 1 : 10000 with extracts of unmodified seed. We estimated the concentration of DNA in those extracts by gel electrophoresis to yield about 1 µg/µl. 1 µl of the diluted sample 1 : 1000 contains 1µg unmodified DNA and 1 ng modified DNA.
 
 

Primers

The primers were constructed for positions on the 3' end of the CP4 EPSPS gene (Sense) and on the 5' end of the NOS gene (antisense).

Figure 1: Integrated fragment: P-E35S Promoter, CTP4: N-terminal chloroplast transit peptid sequence from Petunia Hybrida EPSPS gene, CP4 EPSPS: bacterial EPSPS gene, NOS: 3' nontranslated region of the nopaline synthase gene (terminator)

The position of the primers: sense 1 and different antisense primers 2, 3, 4 and the length of the amplicons (bp):

Sense primer
1 CP4 EPSPS
5' CATCTCGATCACCGCATCGCCATG 3'

Antisense primers
2 NOS 3'
5' CGTATTAAATGTATAATTGCGG 3'

3 NOS 3'
5` CGCAAGACCGGCAACAGGATTC 3'

4 NOS 3'
5' TGCCAAATGTTTGAACGATC 3'
 
 

PCR and DNA analysis

PCR was carried out in a total volume of 50 µl containing 5 µl 10 X buffer I (15 mM Mg2+) (Perkin Elmer), 1 µl BSA (Serva) (2mg/ml), 4 µl dNTP (5mM), 5 µl primer sense (1 µM), 5 µl primer antisense, 24.5 µl A.dem., 5 µl template, 0.5 µl Taq Polymerase (Perkin Elmer). Two drops of mineral oil was added.

First denaturation (hotstart) at 94 °C for 5 min, then Taq polymerase was added. 40 cycles were performed at 95 °C 30 s, 53 °C 30 s and 72 °C 60 s, final extension 72 °C 5 min.

DNA analysis was performed with AluI yielding a visible restriction product of 204 bp. The 388 bp fragment was sequenced confirming the results obtained by restriction analysis.

Discussion
 The performance of PCR utilizing the above listed primers and the Promega extraction procedure is qualified for identification of GTS in food, as we have shown for Nestle "Sondennahrung" (Fig. 2, Fig. 4). The sensitivity is enough to identify in a sample 300 pg template DNA beside 1 µg unmodified Soya DNA. (Fig. 3)
 

Figure 2: Agarose gel electrophoresis of a PCR of genetically modified soya (GTS ) lane 1: 100 base pair ladder (Gibco); lane 2: negative control (without template); lane 3: soya seed DNA extract (primer 1 and 2); lane 4: soya seed DNA extract (primer 1 and 3); lane 5: GTS extract (primer 1 and 2); lane 6: GTS extract (primer 1 and 3); lane 7: nested PCR; lane 8: GTS extract (primer 1 and 4)lanes 9-13 PCR, applying different conditions
 

Figure 3: Sensitivity test, lane 1: 100 base pair ladder (Gibco), lane 2: negative control, without template, lane 3: GTS 1: 10 diluted with soya DNA extract, lane 4: 1:100 ; lane 5: 1:1000 ; lane 6: 1:3000 ; lane 7: 1 : 10000

Figure 4: 100 bp ladder (Gibco), lane 2: Negative control, without template, lane 3: nonmodified soya seed DNA extract, lane 4: soya flour DNA extract ; lane 5: GTS DNA extract; lane 6: Nestle Sondennahrung DNA extract
 
 
 

Literature:

/1/ United States Patent, G.F. Barry et al., Monsanto Company, St Louis, Mo., Patent Number 5,633,435 Date of Patent May 27, 1997

/2/S.R. Padgette et al., Crop Sci. 35:1451-1461 (1995)

/3/E. Köppel et. al., Mitt. Gebiete Lebnsm Hyg. 88, 164-175 (1997)

/4/J.A. Straub et al., Z Lebensm Unters Forsch A (1999) 208: 77-82